View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1540_high_12 (Length: 261)
Name: NF1540_high_12
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1540_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 907269 - 907500
Alignment:
| Q |
30 |
atcaccggctacatacttagcctcagttaatgcaaatgaagatgttttcattatgtcacccattgattcctttgttgaaacaatctttttcaagatctga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907269 |
atcaccggctacatacttagcctcagttaatgcaaatgaagatgttttcattatgtcacccattgattcctttgttgaaacaatctttttcaagatctga |
907368 |
T |
 |
| Q |
130 |
cgaaactgaacagttaaagcatcacttttcttcttgagaagagcatgtcctcttgttgctccaaccaaacgtgccttaaccactccaagcattgtcactg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907369 |
cgaaactgaacagttaaagcatcacttttcttcttgagaagagcatgtcctcttgttgctccaaccaaacgtgccttaaccactccaagcattgtcactg |
907468 |
T |
 |
| Q |
230 |
tggggaccacattcaaacgttgtgattgcccc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
907469 |
tggggaccacattcaaacgttgtgattgcccc |
907500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University