View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1540_high_13 (Length: 255)
Name: NF1540_high_13
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1540_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 11 - 104
Target Start/End: Complemental strand, 908014 - 907921
Alignment:
| Q |
11 |
cataggtacctaaatagcaaatttcatattcaacttacatagtgccccttaagtcacaattaaaagcccaataaatagttatatccaataattg |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
908014 |
cataggtacctaaatagtaaatttcatattcaacttacatagtgctccttaagtcacaattaaaagcccaataaatagttatatccaataattg |
907921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 255
Target Start/End: Complemental strand, 907845 - 907790
Alignment:
| Q |
204 |
tcattctcctttctcgatc----gatctccgatcagcaacttcatcaggttagtcc |
255 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
907845 |
tcattctcctttctcgatcgatcgatctccgatcagcaacttcatcaggttagtcc |
907790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University