View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1540_high_17 (Length: 235)
Name: NF1540_high_17
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1540_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 40840084 - 40839889
Alignment:
| Q |
16 |
gaagacttaacgttttgcttgcagggtctgttatcagctgcaagtatagacagcaattgcggattgacaagacactgcccaagaagacgtaaagagtatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40840084 |
gaagacttaacgttttgcttgcagggtctgttatcagctgcaagtatagacagcaatttcggattgacaagacactgcccaagaagacgtaaagagtatc |
40839985 |
T |
 |
| Q |
116 |
gtatgctagcaacaaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttagtggtttctacaaggatattgg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40839984 |
gtatgctagcaacaaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttggtggtttctacaaggatattgg |
40839889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University