View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1540_low_12 (Length: 368)
Name: NF1540_low_12
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1540_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 128 - 356
Target Start/End: Original strand, 21172034 - 21172260
Alignment:
| Q |
128 |
aggaaactcaaatgatacttataagttataacaacattgctacatcattttataactaaagaatacattcaaaattgagattttccacttagcccaccgg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21172034 |
aggaaactcaaatgatacttataagttataacaacattgctatatcattttataactaaagaatacattcaaaattgagattttccacttag-ccaccgg |
21172132 |
T |
|
| Q |
228 |
ttatttgataactatagtataataataaagtaaagggaagaatactaggccaatcgtcattttggtcgtagtgtttggaaagtgtcacaattctggtagc |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21172133 |
ttatttgataactatagtataataataaagtaaagggaagaatactaggcc-atcgtcattttggtcgtagtgtttggaaagtgtcacaattctggtagc |
21172231 |
T |
|
| Q |
328 |
tgtacccatcaattcatagtcctgctctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21172232 |
tgtacccatcaattcatagtcctgctctg |
21172260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 63
Target Start/End: Original strand, 21171543 - 21171576
Alignment:
| Q |
30 |
caactgtctagaaacttcaccacaattcaagaaa |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21171543 |
caactgtctagaaacttcaccacaattcaagaaa |
21171576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University