View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1540_low_18 (Length: 291)
Name: NF1540_low_18
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1540_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 48 - 220
Target Start/End: Original strand, 32829447 - 32829619
Alignment:
| Q |
48 |
cgaataatatgtgtcatcctcctcacccttgcgcctctctcgtctccctcatcaatcatcttatgacgaggcattggcatgtacaagttattcacatcta |
147 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32829447 |
cgaacaatgtgtatcatcctcctcacccttgcgcctctctcatctccctcatcaatcatcttatgacgaggcattggcatgtacaagttattcacatcta |
32829546 |
T |
|
| Q |
148 |
ttggcaaagacaacggactgaattgcaggttacactttttcactacctaaaggttcacatatccttccccacg |
220 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32829547 |
ttggcaaagacaacagactgaattgcaggttacactttttcactacctaaaggttcacatatccttccccacg |
32829619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University