View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1540_low_24 (Length: 243)
Name: NF1540_low_24
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1540_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 23 - 152
Target Start/End: Complemental strand, 29215455 - 29215323
Alignment:
| Q |
23 |
ttaaatactaattcacatgtgctaagtatatgcgtattattacacatgtgttcgaaatgtttattttgcaatgcactttcatgtaggccttaataaacgc |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29215455 |
ttaagtactaattcacatgtgctaagtatatgcgtattattacacatgtgttcgaaatgtttattttgcaatgcactttcatgtaggccttaataaacgc |
29215356 |
T |
|
| Q |
123 |
aatg---caagagcgtcgacaagtattcttagt |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
29215355 |
aatgcaacaagagcgtcgacaagtattcttagt |
29215323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 14606495 - 14606565
Alignment:
| Q |
157 |
ctgaatccggtagcttttctatgtgagtaccagaaaggtctagataacggagatgcttgagattgcctatg |
227 |
Q |
| |
|
|||||||| ||||||| | ||||| |||||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
14606495 |
ctgaatccagtagcttctttatgttggtaccagagacgtctagaaaacggagatgcttgagattgcctatg |
14606565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 226
Target Start/End: Complemental strand, 14297344 - 14297276
Alignment:
| Q |
158 |
tgaatccggtagcttttctatgtgagtaccagaaaggtctagataacggagatgcttgagattgcctat |
226 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||||||| |||||||||||||| || ||||| ||||| |
|
|
| T |
14297344 |
tgaatccggtagcttttttatgtttgtatcagaaaggtcgagataacggagatgtttaagatttcctat |
14297276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 184 - 227
Target Start/End: Complemental strand, 14312399 - 14312356
Alignment:
| Q |
184 |
taccagaaaggtctagataacggagatgcttgagattgcctatg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
14312399 |
taccagaaaggtctagataacggagatgtttaagattgcctatg |
14312356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University