View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15410_high_14 (Length: 246)
Name: NF15410_high_14
Description: NF15410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15410_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 4155368 - 4155146
Alignment:
| Q |
7 |
tttacttgatatattaagtacatgccttgaaatacttctgaaaatccatcagccttctcaaaccaataaaccgataaacttgaagacggatgaatttgca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4155368 |
tttacttgatatattaagtacatgccttgaaatactcttgaaaatccatcagccttctcaaaccaataaaccgataaacttgaagatggatgaatttgca |
4155269 |
T |
|
| Q |
107 |
ggagtatttccagttatgtccttattaaccttgattatgatagatgtttcattgacgaattgctccatccttttagtagttctctgtcaaaaccaaaaat |
206 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4155268 |
ggagtatctccaattatgtccttattaaccttgattatgatatatgtttcattcacgaattgctccatccttttagtagttctctgtcaaaaccaaaaat |
4155169 |
T |
|
| Q |
207 |
caatgttaacacttaataataat |
229 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
4155168 |
caatgttaacacttaatattaat |
4155146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 95 - 207
Target Start/End: Original strand, 26789852 - 26789966
Alignment:
| Q |
95 |
gatgaatttgcaggagtatttccagttatgtccttattaaccttgattatgata-gatgtttcattgacgaattgctccatccttttagta-gttctctg |
192 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| ||||| |||||||||||| ||||| || ||| |||| |||||||||||||||||||| || ||| ||| |
|
|
| T |
26789852 |
gatggatttgctggagtatttccaggtatatccttgttaaccttgattttgataggaattttgattgtcgaattgctccatccttttaataggtttcctg |
26789951 |
T |
|
| Q |
193 |
tcaaaaccaaaaatc |
207 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26789952 |
tcaaaaccaaaaatc |
26789966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University