View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15410_high_17 (Length: 237)
Name: NF15410_high_17
Description: NF15410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15410_high_17 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
| [»] scaffold0592 (1 HSPs) |
| | |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 38063955 - 38063848
Alignment:
| Q |
130 |
aaattaaaatatataaacaattgagaaggcagcgtgtggactgtgttatcctataattgttggactgcgtttaaattagtttataaattttatttgaaaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38063955 |
aaattaaaatatataaacaattgagaaggcagcgtgtggactgtgttatcctataattgttggactgtgtttaaattagtttataaattttatttgaaaa |
38063856 |
T |
|
| Q |
230 |
ttgtgtat |
237 |
Q |
| |
|
|||||||| |
|
|
| T |
38063855 |
ttgtgtat |
38063848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 38064078 - 38064002
Alignment:
| Q |
2 |
cttaaattaaaaactcggaaaagcgtggattgatagatagtatttatttatttaaatgtggatatgagaaccgatagttgtg |
83 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38064078 |
cttaaattaaaaactcgaaaaagc-----ttgatagataatatttatttatttaaatgtggatatgagaaccgatagttgtg |
38064002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 202
Target Start/End: Original strand, 1312 - 1366
Alignment:
| Q |
148 |
aattgagaaggcagcgtgtggactgtgttatcctataattgttggactgcgttta |
202 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
1312 |
aattgagaaggcagtgtgtggagtgtgttatcctataattgttggattgtgttta |
1366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 94252 - 94291
Alignment:
| Q |
163 |
gtgtggactgtgttatcctataattgttggactgcgttta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
94252 |
gtgtggactgtgttatcctataattgttggattgtgttta |
94291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University