View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15410_high_9 (Length: 303)
Name: NF15410_high_9
Description: NF15410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15410_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 155 - 287
Target Start/End: Original strand, 38064193 - 38064325
Alignment:
| Q |
155 |
ttccaattccataataaaacagaagagttattacagtcgaccatacaaaagataacgttgcaagagccaacaatttaaagttcatcaaaattgttggaag |
254 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38064193 |
ttccaattccataataaaacagaagtgttattacagtcgaccatacaaaagataccgttgcaagagccaacaatttaaagttcatcaaaattgttggaag |
38064292 |
T |
 |
| Q |
255 |
gatacatgagcttggtgatacgtcggtggttac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38064293 |
gatacatgagcttggtgatacgtcggtggttac |
38064325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 38064068 - 38064193
Alignment:
| Q |
1 |
tttaatttaaggattaatggtgttttttctccgataaataaatatgtcatttcctgtttaattttacaaaaaatttagtttggaataatttcttttcaaa |
100 |
Q |
| |
|
||||||||||| ||||| || ||||| |||||||||||||||||||| ||||| |||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38064068 |
tttaatttaagagttaatagt-tttttcctccgataaataaatatgtcgtttccggtttaactttacaaaaattttagtttggaataatttcttttcaaa |
38064166 |
T |
 |
| Q |
101 |
ttcacttttggcttttcaataagcggt |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38064167 |
ttcacttttggcttttcaataagcggt |
38064193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University