View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15410_low_21 (Length: 242)
Name: NF15410_low_21
Description: NF15410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15410_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 50407758 - 50407631
Alignment:
| Q |
19 |
agagatcagttcaatctctaaaattattgactctacttaataattagagttggattggaaatacgtcaattttacttggaaactccatgtcttctcttgt |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50407758 |
agagatcagttcaatctctaagattattgactctacttaataattagagttgtattgaaaatacgtcaattctacttggaaactccatgtcttctcttgt |
50407659 |
T |
 |
| Q |
119 |
ccacccgcttgctattaacgttatctct |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
50407658 |
ccacccgcttgctattaacgttatctct |
50407631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 50407559 - 50407510
Alignment:
| Q |
181 |
tatctcatgtcaataaaggttggttcaattgcgtaagtactcaattgatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50407559 |
tatctcatgtcaataaaggttggttcaattgcgtaagtactcaattgatt |
50407510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University