View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15411_low_4 (Length: 252)
Name: NF15411_low_4
Description: NF15411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15411_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 27927117 - 27927354
Alignment:
| Q |
1 |
agatttcagtttgaaaagaaatgaattagtgactagtggttgatatctttcaacttatagaaatctatctcttaacaaaatcaaatgtgatttcatgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27927117 |
agatttcagtttgaaaagaaatgaattagtgactagtggttgatatctttcaacatatagaaatctatctcttaacaaaatcaaatgtgatttcatgtgt |
27927216 |
T |
|
| Q |
101 |
cgatacaaaaataaatgcacattcaattctcagtttgagtgtcctcttgatttttattgtcgaggatatacttcagatttgtcatgtagacgtacgtagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27927217 |
ggatacaaaaataaatgcacattcaattctcagtttgagtgtccacttgatatttattgtcgaggatatacttcagatttgtcatgtag----acgtagt |
27927312 |
T |
|
| Q |
201 |
ccacgttttagtacttccaattcattgtgcaattgttttctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27927313 |
ccacgttttagtacttccaattcattgtgcaattgttttctt |
27927354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University