View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15411_low_5 (Length: 236)
Name: NF15411_low_5
Description: NF15411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15411_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 27927062 - 27926841
Alignment:
| Q |
1 |
tttagttaattaaataaagaaatcaacacaaatcttgtccaaccaattattttaatgatttcaaacacaattcctcttacatctccaccaagctcacttt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27927062 |
tttagttaattatataaagaaatcaacacaaatcttgtccaatcaattattttaatgattccaaacacaattcctcttacatctccgccaagctcacttt |
27926963 |
T |
 |
| Q |
101 |
tgttttcatggatccaaatctaatgttacattgacatctcttgcttagggttttaaaaaatccatactttaaaatttaaaaatatccatcaaattccaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27926962 |
tgttttcatggatccaaatctaatgttacattgacatctcttgcttagggttttaaaaaatccatactttaaaatttaaaaatatccatcaaattccaat |
27926863 |
T |
 |
| Q |
201 |
cgattctttttaatgatgattc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27926862 |
cgattctttttaatgatgattc |
27926841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 27932615 - 27932578
Alignment:
| Q |
1 |
tttagttaattaaataaagaaatcaacacaaatcttgt |
38 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27932615 |
tttagttaattaaataaagtaatcaacacaaatcttgt |
27932578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University