View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15412_low_3 (Length: 234)

Name: NF15412_low_3
Description: NF15412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15412_low_3
NF15412_low_3
[»] chr7 (1 HSPs)
chr7 (18-217)||(33834967-33835164)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 33835164 - 33834967
Alignment:
18 taatacttttgtttttcgttacgatatgattagcctcactcttcttgatgtaattgtcattcttgaactttctttaattggagaagaagcctcatctgcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33835164 taatacttttgtttttcgttacgatatgattagcctcactcttcttgatgtaattgtcattcttgaactttctttaattggagaagaagcctcatctgcc 33835065  T
118 tatatttttccccaatccccaattcgaggattgctttttcaaagaacacctttaggtattccaaatttttggcttccatgttgaagtcgtccatgtcatt 217  Q
    ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33835064 tata--tttccccaatccccaattcgaggattgctttttcaaagaacacctttaggtattccaaatttttggcttccatgttgaagtcgtccatgtcatt 33834967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University