View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_high_31 (Length: 258)
Name: NF15414_high_31
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 40 - 243
Target Start/End: Original strand, 3525183 - 3525383
Alignment:
| Q |
40 |
ctcaaaacatttgttatatttttcggatgtgccctttaaaaaattaaatgggatgtgaaaacgcattgactattttcttgctccaccaaatcaactttct |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3525183 |
ctcaaaacatttgttatatttttcggatgtgccctttaaaaaa---aatgggatgtgaaaacacattgactattttcttgctccaccaaatcaactttct |
3525279 |
T |
|
| Q |
140 |
cgatccgtcagtgccttcttcttcctaatgaaacaatacaaatgcccaaataaaaaggatgatgcagattctagttaaagtagctttgccagcagctcct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3525280 |
cgatccgtcagtgccttcttcttcctaatgaaacaatacaaatgcccaaataaaaaggatgatgcagattctagttaaagtagctttgccagcaactcct |
3525379 |
T |
|
| Q |
240 |
cctt |
243 |
Q |
| |
|
|||| |
|
|
| T |
3525380 |
cctt |
3525383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University