View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_high_41 (Length: 219)
Name: NF15414_high_41
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 49331365 - 49331548
Alignment:
| Q |
17 |
caaaggtttggctgatttggatgctgcactttgtctttgcactgcaattaaggccaatgtgcttggaataaacttgaacgtacctctcaccctcacctgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49331365 |
caaaggtttggctgatttggatgctgcactttgtctttgcactgcaattaaggccaatgtgcttggaataaacttgaacgtacctctcaccctcacctgg |
49331464 |
T |
|
| Q |
117 |
atccttggtgcttgtcaaaaaacaatccctcctggttttcaatgtgcctaaggattcaaattaggttgtatctcattgtttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49331465 |
atccttggtgcttgtcaaaaaacaatccctcctggttttcaatgtgcctaaggattcaaattaggttgtatctcattgtttcct |
49331548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 21 - 196
Target Start/End: Original strand, 49329093 - 49329268
Alignment:
| Q |
21 |
ggtttggctgatttggatgctgcactttgtctttgcactgcaattaaggccaatgtgcttggaataaacttgaacgtacctctcaccctcacctggatcc |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||| || |||||||| || ||| |||| || ||| |||| |||| || | ||| |
|
|
| T |
49329093 |
ggtttggctgatttggaggctgcactttgtctttgcactgcacttaaggctaacgtgcttgggatcaacctgaatgtgcctatcactctcagcttgctcc |
49329192 |
T |
|
| Q |
121 |
ttggtgcttgtcaaaaaacaatccctcctggttttcaatgtgcctaaggattcaaattaggttgtatctcattgtt |
196 |
Q |
| |
|
|| |||| ||||||||||| ||||||||||||| |||||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
49329193 |
ttagtgcatgtcaaaaaaccgtccctcctggtttccaatgtccctaaggattccaattaggttgtgtctcattgtt |
49329268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 2592105 - 2592030
Alignment:
| Q |
19 |
aaggtttggctgatttggatgctgcactttgtctttgcactgcaattaaggccaatgtgcttggaataaacttgaa |
94 |
Q |
| |
|
||||||||||||||||||| || ||| |||||||||| || || |||||||| ||||| ||||| || |||||||| |
|
|
| T |
2592105 |
aaggtttggctgatttggacgcagcagtttgtctttgtaccgctattaaggctaatgttcttggtatcaacttgaa |
2592030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 2578356 - 2578281
Alignment:
| Q |
19 |
aaggtttggctgatttggatgctgcactttgtctttgcactgcaattaaggccaatgtgcttggaataaacttgaa |
94 |
Q |
| |
|
||||||||||||||||||| || ||| |||||||||| || || |||||||| || || ||||| || |||||||| |
|
|
| T |
2578356 |
aaggtttggctgatttggacgcagcagtttgtctttgtaccgctattaaggctaacgttcttggtatcaacttgaa |
2578281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 2599859 - 2599784
Alignment:
| Q |
19 |
aaggtttggctgatttggatgctgcactttgtctttgcactgcaattaaggccaatgtgcttggaataaacttgaa |
94 |
Q |
| |
|
||||||||||||||||||| || ||| |||||||||| || || |||||||| || || ||||| || |||||||| |
|
|
| T |
2599859 |
aaggtttggctgatttggacgcagcagtttgtctttgtaccgctattaaggctaacgttcttggtatcaacttgaa |
2599784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University