View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_high_45 (Length: 204)
Name: NF15414_high_45
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 44 - 191
Target Start/End: Original strand, 46034658 - 46034805
Alignment:
| Q |
44 |
tggcaacatcattttggtttgagtgataatgattatccaataattgaaggagaaacttacttaaatctcttgttacaaatagtggttgtagattgaagtt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46034658 |
tggcaacatcattttggtttgagtgataatgattatccaataattgaaggagaaacttacttaaatctcttgttacaaatagtggttgtagatagaagtt |
46034757 |
T |
 |
| Q |
144 |
aaacactactttaggacatgatgtatcaaatacgccctagttgtttgt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46034758 |
aaacactactttaggacataatgtatcaaatacgccctagttgtttgt |
46034805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University