View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_low_39 (Length: 241)
Name: NF15414_low_39
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 28 - 226
Target Start/End: Original strand, 941060 - 941258
Alignment:
| Q |
28 |
agcaagcataggagacctttggactcttgcagtggttattttggtcaatttacatttggctatggatgttgttagatggtattgggtgactcatgctgtc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
941060 |
agcaagcataggagacctttggactcttgcagtggttattttggtcaatttacatttggctatggatgttgttagatggtattgggtgactcatgctgtc |
941159 |
T |
|
| Q |
128 |
atttggggatctattcttgctacattcatttctgtcatgatcattgatgctatacctcaacttcctggttactggtatgtattcactatactttcccta |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
941160 |
atttggggatctattcttgctacattcatttctgtcatgatcattgatgctatacctcaacttcctggttactggtatgtattcactatactttcccta |
941258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University