View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_low_41 (Length: 236)
Name: NF15414_low_41
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 45526036 - 45526256
Alignment:
| Q |
1 |
ttttgatgttttagttatgtctgtgggtaagcttttttataaaaccattttgatacaaataatttagagagtatatttttagagatttctaaccaaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45526036 |
ttttgatgttttagttatgtctgtgggtaagcttttttataaaaccattttgatacaaataatttagagagtatatttttagagatttctaaccaaagta |
45526135 |
T |
 |
| Q |
101 |
tgctatattgtgtttgttaatttgtttaaaattatatgtagagattttgtatttctccctccagttgaagatgattttcttcaaaagctaatccaattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45526136 |
tgctatattgtgtttgttaatttgtttaaaattatatgtagagattttgtatttctccctccagttgaagatgattttcttcaaaagctaatccaattag |
45526235 |
T |
 |
| Q |
201 |
cttttcattttcagcataaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45526236 |
cttttcattttcagcataaaa |
45526256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 221
Target Start/End: Original strand, 47962385 - 47962435
Alignment:
| Q |
171 |
atgattttcttcaaaagctaatccaattagcttttcattttcagcataaaa |
221 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
47962385 |
atgattttcttccaaagctaatcaaattagcttttcatttttagcataaaa |
47962435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University