View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_low_42 (Length: 233)
Name: NF15414_low_42
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 22 - 220
Target Start/End: Original strand, 40403568 - 40403766
Alignment:
| Q |
22 |
atgtgtacactgtacctatgattccataatgggtgattggaaggaggaaatatcaaccagaaaaatgctaatgtttatttagaattgaatgcgatttatg |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40403568 |
atgtgtacactgtacctatgattccaaaatgggtgattggaaggaggaaatatcaaccagaaaaatgctaatgtttatttagaattgaatgcgatttatg |
40403667 |
T |
 |
| Q |
122 |
tgtcaatttgttcttcaacgttcttgatttctagatggtttatagagttgcttatatttataaagtttcttaataagcccactgtttctgctctgaaga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40403668 |
tgtcaatttgttcttcaacgttcttgatttctagatggtttatagagttgcttatatttataaagtttcttaataagcccactgtttctgctctgaaga |
40403766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University