View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15414_low_44 (Length: 227)
Name: NF15414_low_44
Description: NF15414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15414_low_44 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 28 - 227
Target Start/End: Original strand, 25609529 - 25609727
Alignment:
| Q |
28 |
agaatagtggaaagaagaactatgcagatccggaaggcaacaatacttcttcagaagggggttcatacttatctgctgatgccacatagttcttcagtaa |
127 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25609529 |
agaatagtgcaaagaagaactatgcagatccggaaggcgacaatacttcttcagaagggggttcatacttatctgctgatgccacagagttcttcagtaa |
25609628 |
T |
 |
| Q |
128 |
accaatcaaggttaaaagnnnnnnnattagacttgttacaaaacgagaagctcccgttgtaagatcaatttctgttactaaactttggagaaaaacataa |
227 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25609629 |
accaatgaaggttaaaag-ttttttattagacttgttacaaaacgagaagctcccgttgtaagatcaatttctgttactaaactttggagaaaaacataa |
25609727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University