View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15415_low_29 (Length: 269)
Name: NF15415_low_29
Description: NF15415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15415_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 42038170 - 42038009
Alignment:
| Q |
1 |
aatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaattctcgacagcccattaggtttggtccctctccctgttcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038170 |
aatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaatcctcgacagcccattaggtttggtccctctccctgttcccc |
42038071 |
T |
 |
| Q |
101 |
tagggaatgggcaacttccgacgagtagtctggttttggaggttattctcaggtttttggga |
162 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42038070 |
tagggaatgggcaacttccgacgggtagtctggttttgtaggttattctcaggtttttggga |
42038009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 269
Target Start/End: Complemental strand, 42037940 - 42037902
Alignment:
| Q |
231 |
ggtacccctggggctcaggctgctattttctgtttgttt |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42037940 |
ggtacccctggggctcaggctgctactttctgtttgttt |
42037902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University