View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15415_low_37 (Length: 230)
Name: NF15415_low_37
Description: NF15415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15415_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 45343243 - 45343171
Alignment:
| Q |
13 |
gagatgaagaaacaaaaaaggcgcatttgctttggtagctcatcattaaccaaagagaatgtgaatgatacta |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343243 |
gagatgaagaaacaaaaaaggcgcatttgctttggtagctcatcattaaccaaagagaatgtgaatgatacta |
45343171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 135 - 201
Target Start/End: Complemental strand, 45343138 - 45343072
Alignment:
| Q |
135 |
cacggccacagttaaaacttaaaactccccacgtgcggttcctctaactaaccatggttaaatccaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343138 |
cacggccacagttaaaacttaaaactccccacgtgcggttcctctaactaaccatggttaaatccaa |
45343072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University