View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15416_high_17 (Length: 215)
Name: NF15416_high_17
Description: NF15416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15416_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 44490229 - 44490056
Alignment:
| Q |
20 |
attcaccataatagaatcacctatactatagtcatgtgttgcacgaattgaactcaaatccaacacaaaccccaaccaaccactacatatataaattttg |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44490229 |
attcaccataatagaatcacctata-----gtcatgtgttgcacgaattgaactcaaatccaacacaaaccccaaccaaccactacatatataaaatttg |
44490135 |
T |
 |
| Q |
120 |
aaatctagctagctctctttctatattgcaatattgcatgtcctttataacaatgggttggaaagccttctctattgct |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44490134 |
aaatctagatagctctctttctatattgcaatattgcatgtcctttataacaatgggttggaaagccttctctattgct |
44490056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University