View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15416_high_6 (Length: 363)
Name: NF15416_high_6
Description: NF15416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15416_high_6 |
 | |
|
| [»] scaffold0036 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 83 - 344
Target Start/End: Complemental strand, 42468 - 42207
Alignment:
| Q |
83 |
tattattgcattgcaggctacaccctcacccttgatctaggcgcacgaggcgaggattaaaacatattctcaactagtagtttctcaggtgaagagagaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42468 |
tattattgcattgcaggctacaccctcacccttgatctaggcgcacgaggcgaggattcaaacatattctcaactagtagtttctcaggtgaagagagaa |
42369 |
T |
|
| Q |
183 |
gccatgcaaaggaaccattggtccagaagtaccttctcatagtcaggaaaaatctcacttctttcgattcttatgaaatcatccatgt-ccccagaaaac |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | || |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42368 |
gccatgcaaaggaaccattggtccagaagtaccttctcgtggttaggaaaaatctcac-tctttcgattcttatgaaatcatccatgtcccccagaaaac |
42270 |
T |
|
| Q |
282 |
aaaatacaagagcagatgttctatcaaaattaggaagtacatgctcgatagggatcaaagact |
344 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| | |||||||||||||| |||| |
|
|
| T |
42269 |
aaaatacaagagcagatgttctatcaaacttaggaagtacacgttcgatagggatcaacgact |
42207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 39
Target Start/End: Complemental strand, 42499 - 42469
Alignment:
| Q |
9 |
gatgaaggtctggtggtcgaaatctcaatat |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42499 |
gatgaaggtctggtggtcgaaatctcaatat |
42469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University