View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15416_low_20 (Length: 212)
Name: NF15416_low_20
Description: NF15416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15416_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 10 - 212
Target Start/End: Original strand, 1733875 - 1734080
Alignment:
| Q |
10 |
gtaatatgttggtttaacttttcttttttaagtttaaatctttggaaaggtgggtagtgtagcacaaagaattgtaatactatatcgatcgatcctcatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1733875 |
gtaatatgttggtttaacttttcttttttaagtttaaatctttggaaaggtgggcagtgtagcacaaagaattgtaatactatatcgatcgatcctcatg |
1733974 |
T |
 |
| Q |
110 |
cttaatgattatttgtgctaagtcattttgtctcccacattcatttaaaagtg---aaaacttgataagcttaatgacatgacatgaaaacccaaagatt |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1733975 |
cttaatgattatttgtggtaagtcattttgtctcccacattcatttaaaagtgaaaaaaacttgataagcttaatgacatgacatgaaaacccaaagatt |
1734074 |
T |
 |
| Q |
207 |
cagatc |
212 |
Q |
| |
|
|||||| |
|
|
| T |
1734075 |
cagatc |
1734080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University