View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15418_low_5 (Length: 248)
Name: NF15418_low_5
Description: NF15418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15418_low_5 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 143 - 248
Target Start/End: Original strand, 26305987 - 26306091
Alignment:
| Q |
143 |
atcagagccagtacagaacaaattgaatgaaaatatggaacataaacgagtttttacctctgagataaacaccgtttcgagcaagatgaagaacacgaat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305987 |
atcagagccagtacagaacaaattgaatgaaaatatggaacataaacgagtttt-acctctgagataaacaccgtttcgagcaagatgaagaacacgaat |
26306085 |
T |
|
| Q |
243 |
gagatg |
248 |
Q |
| |
|
|||||| |
|
|
| T |
26306086 |
gagatg |
26306091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 83 - 147
Target Start/End: Original strand, 26305894 - 26305958
Alignment:
| Q |
83 |
ttgtgtaccgcagttttgaactatgtgtgacagaatacacatttaagaacaaacattacgatcag |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305894 |
ttgtgtaccgcagttttgaactatgtgtgacagaatacacatttaagaacaaacattacgatcag |
26305958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 26305842 - 26305898
Alignment:
| Q |
1 |
caattgtgacagtatagttctaaaatgctgacaaatgcagctacaaatatgattgtg |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305842 |
caattgtgacagcatagttctaaaatgctgacaaatgcagctacaaatatgattgtg |
26305898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University