View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15418_low_7 (Length: 226)
Name: NF15418_low_7
Description: NF15418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15418_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 212
Target Start/End: Complemental strand, 26306259 - 26306069
Alignment:
| Q |
22 |
attgtttggttttggtgtcattgttgagtttgtgttggtgtttattacagcaaagataacaacaaaacaagttcatcaaaaacaagcatggaaacaaaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26306259 |
attgtttggttttggtgtcattgttgagtttgtgttggtgtttattacagcaaagataacaacaaaacaagttcatcaaaaacaagcatggaaacaaaag |
26306160 |
T |
 |
| Q |
122 |
gtggagaagttagaaggcttcacataatctacttccttagtcacatgggtggtcatgcagaacatcctcatctcattcgtgttcttcatct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26306159 |
gtggagaagttagaaggcttcacataatctacttccttagtcacatgggtggtcatgcagaacatcctcatctcattcgtgttcttcatct |
26306069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 43 - 208
Target Start/End: Complemental strand, 46209506 - 46209350
Alignment:
| Q |
43 |
tgttgagtttgtgttggtgtttattacagcaaagataacaacaaaacaagttcatcaaaaacaagcatggaaacaaaaggtggagaagttagaaggcttc |
142 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| |||||||||||||| ||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
46209506 |
tgttgagtttgtgttgatgtttattgcagcaaagacaacaacaaaacaagg------aaaacaagcatggaagcaaagtgtg---aagttagaaggcttc |
46209416 |
T |
 |
| Q |
143 |
acataatctacttccttagtcacatgggtggtcatgcagaacatcctcatctcattcgtgttcttc |
208 |
Q |
| |
|
||||||||| ||| |||| ||||||||||| |||||||||| || ||||||| ||||||||| |
|
|
| T |
46209415 |
acataatctgcttatttagctacatgggtggttttgcagaacattatcgtctcattagtgttcttc |
46209350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 130 - 212
Target Start/End: Complemental strand, 781550 - 781468
Alignment:
| Q |
130 |
gttagaaggcttcacataatctacttccttagtcacatgggtggtcatgcagaacatcctcatctcattcgtgttcttcatct |
212 |
Q |
| |
|
||||||| |||||| ||||| |||||||||||||||||| |||||||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
781550 |
gttagaatgcttcatataatgtacttccttagtcacatgcgtggtcattcagaacagcctcatctctttcgtgttcttcatct |
781468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University