View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15418_low_8 (Length: 223)
Name: NF15418_low_8
Description: NF15418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15418_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 29 - 209
Target Start/End: Original strand, 44432521 - 44432695
Alignment:
| Q |
29 |
attgtttttatttttagtgtggacacatgaaatacaattgagtttgagcatttcaatatatggttatggttgagtatttttatgttagacaatttttacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
44432521 |
attgtttttatttttagtgtggacacatgaaatacaattgagtttgagcatttcaatatatg------gttgagtatttttatgtcagacaatttttacc |
44432614 |
T |
 |
| Q |
129 |
tgggaaatgagaaacttaattgatgtcagatttaatggccagaaacatgcttatctgattttttgtgttttgtttctctgc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44432615 |
tgggaaatgagaaacttaattgatgtcagatttaatggccagaaacatgcttatctgattttttgtgttttgtttctctgc |
44432695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University