View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15419_low_4 (Length: 281)
Name: NF15419_low_4
Description: NF15419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15419_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 42948070 - 42947800
Alignment:
| Q |
1 |
ctttctaatctgcagctcgaaagtataaaactggaataaaccacaatcaacagaggctcaatatggggccaaatgccattaataccgcatagctagcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42948070 |
ctttctaatctgcagctcgaaagtataaaactggaataaaccacaatcaacagaggctcaatatggggccaaatgccattaataccacatagctagcatc |
42947971 |
T |
 |
| Q |
101 |
tcatgcaacacacaaataagttaagcttgattcgataagagatgagattacgagatcttgcaatagatacgctatcaaacatgacaagctatcaaggtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42947970 |
tcatgcaacacacaaataagttaagcttgattcaataagagatgagattacgagatcttgcaatagatacgctatcaaacatgacaagctatcaaggtga |
42947871 |
T |
 |
| Q |
201 |
aaacgaaaactagagctagaggtcgtactttatgtatttatttatgcatatgctcatgcaacttgcctttg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42947870 |
aaacgaaaactagagctagaggtcgtactttatgtatttatttatgcatatgctcatacaacttgcctttg |
42947800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University