View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_high_16 (Length: 316)
Name: NF1541_high_16
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 307
Target Start/End: Original strand, 29665383 - 29665674
Alignment:
| Q |
16 |
taaacaacgcaaacaaaagggtccagatgccgcttcacggttaccgacggtgactccggtatcgaagtgcaagctgaggctgttaaagcttgagagggtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29665383 |
taaacaacgcaaacaaaagggtccagatgccgcttcacggttaccgacggtgactccggtatcgaagtgcaagctgaggctgttaaagcttgagagggtg |
29665482 |
T |
 |
| Q |
116 |
aaggattatttgttgatggaggaagagtttgttgcgtatcaagagaggttgaagcctcaggaggaaaaggcggaggaagatagatctaaggttgatgatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29665483 |
aaggattatttgttgatggaggaagagtttgttgcgtatcaagagaggttgaagcctcaggaggaaaaggcggaggaagatagatctaaggttgatgatc |
29665582 |
T |
 |
| Q |
216 |
tacgtggctctccgatgagtgttgggaatttggaggaattgattgatgagaatcatgcgattgtttcgagttcggttgggccggagtattat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29665583 |
tacgtggctctccgatgagtgttgggaatttggaggaattgattgatgagaatcatgcgattgtttcgagttcggttgggccggagtattat |
29665674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 122 - 307
Target Start/End: Complemental strand, 39968509 - 39968324
Alignment:
| Q |
122 |
tatttgttgatggaggaagagtttgttgcgtatcaagagaggttgaagcctcaggaggaaaaggcggaggaagatagatctaaggttgatgatctacgtg |
221 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||| || |||||||||||||||| || || || || |||||||||||||||||||||||||| |||| |
|
|
| T |
39968509 |
tatttgttgatggaggaagagtttgtagcgaatcaggaacggttgaagcctcaggaagagaaagctgaagaagatagatctaaggttgatgatcttcgtg |
39968410 |
T |
 |
| Q |
222 |
gctctccgatgagtgttgggaatttggaggaattgattgatgagaatcatgcgattgtttcgagttcggttgggccggagtattat |
307 |
Q |
| |
|
| || || ||||| ||||| ||| | || || | ||||||||||||||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
39968409 |
gttcgcctatgagcgttggaaatctcgaagagcttattgatgagaatcatgctattgtttcgagttctgttggaccggagtattat |
39968324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University