View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_high_18 (Length: 299)
Name: NF1541_high_18
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 45556111 - 45555846
Alignment:
| Q |
18 |
ttttaaaactggcactcctattcattgaatagaattgaatgttgctgctactgcctgctgatgacgacttggtgtattgcagccatcgctattgctatgt |
117 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
45556111 |
ttttaaaaatggcactcctattcatcgaatagaattgaatgttgctgctactgcctgctgatgacgacttggtttattgcagccattgctattgctatgt |
45556012 |
T |
 |
| Q |
118 |
gaagccggtggaacaaagaaggaaaaagatgttttaaagtttaaagtttggtcttgcaaattttgtactctagaaaacaatatcaagcttgatagatgct |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45556011 |
gaagcctgtggaacaaagaaggaaaaagatgttttaaagtttaaagtttggtcttgcaaattttgtactctagaaaacaatatcaagcttgatagatgct |
45555912 |
T |
 |
| Q |
218 |
tagcttgtggagaatggagattttcacatggtccactcgtctccccttatgctgggacctaattgg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45555911 |
tagcttgtggagaatggagattttcacatggtccactcgtctccccttatgctgggacctaattgg |
45555846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University