View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_high_19 (Length: 288)
Name: NF1541_high_19
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 255
Target Start/End: Complemental strand, 34869198 - 34868934
Alignment:
| Q |
4 |
atcaatgtaaaagacatctaatttaaaccttgatcacaacgttt-------------taccttttatctaaaaaggcaaaatgataattaactgttagaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869198 |
atcaatgtaaaagacatctaatttaaaccttgatcagaacgtttaatctaaaagttttaccttttatctaaaaaggcaaaatgataattaactgttagaa |
34869099 |
T |
 |
| Q |
91 |
tttattgagaagcttctctcataagctaccgaaaacacgtgaaattatgaaacggtcaacactctgcaactcgcgaaccctagcagcaccgtgtttctcc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34869098 |
tttattgagaagcttctctcataagctaccgaaaacacgtgaaattgtgaaacggtcaacactctgcaactcgcgaaccctagcagcaccgtgtctctcc |
34868999 |
T |
 |
| Q |
191 |
tcttctccatcttccttcttcaactcatcgcggctattttttctagttcttcatctttgttgtga |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34868998 |
tcttctccatcttccttcttcaactcatcgcggttattttttctagttcttcatctttgttgtga |
34868934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University