View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_high_4 (Length: 461)
Name: NF1541_high_4
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 3e-80; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 290 - 445
Target Start/End: Original strand, 1554285 - 1554440
Alignment:
| Q |
290 |
aactattatatgtttttatacactacttttgaagtccttatgtctactgtttacgtacttcaaactctttatattatgcaattatgacaattctcttatt |
389 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1554285 |
aactattatatgtttttatacagtacttttgaagtccttatgtctactgtttacgtacttcaaactctttatattatgcaattatgacaattctcttatt |
1554384 |
T |
 |
| Q |
390 |
tgaagcaattagttgaattctctttcactttttggattgattggtttagttgaaaa |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1554385 |
tgaagcaattagttgaattctctttcactttttggattgattggtttagttgaaaa |
1554440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 1554118 - 1554288
Alignment:
| Q |
9 |
agcagagaatatagatggagtcattatgctacagttttctcttttatgactcctttgacatatggcaaggattcaaattcactagaaggttttgctga-- |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1554118 |
agcagagaatatagatggagtcattatgctacagttttctcttttatgactcctttgacatatggcagggattcaaattcactagaaggttttgctgaat |
1554217 |
T |
 |
| Q |
107 |
--attgtgagtcatgttgcattatgggaagattgttgaagtggatgttaaagacatttgtttgttctaact |
175 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1554218 |
atattgtaagtcatgttgcattatgggaagattgttgaagtggatgttaaagacatttgttttttctaact |
1554288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 370 - 412
Target Start/End: Original strand, 1550709 - 1550751
Alignment:
| Q |
370 |
attatgacaattctcttatttgaagcaattagttgaattctct |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1550709 |
attatgacaattctcttatttgaagcaattagttgaattctct |
1550751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 51 - 96
Target Start/End: Original strand, 1550345 - 1550390
Alignment:
| Q |
51 |
tttatgactcctttgacatatggcaaggattcaaattcactagaag |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
1550345 |
tttatgactcctttgacatatggcagggattcgaattcactagaag |
1550390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 297 - 370
Target Start/End: Original strand, 1550612 - 1550681
Alignment:
| Q |
297 |
atatgtttttatacactacttttgaagtccttatgtctactgtttacgtacttcaaactctttatattatgcaa |
370 |
Q |
| |
|
|||||||||| |||| ||||||||||||| | |||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
1550612 |
atatgttttt-tacagtacttttgaagtcttcatgtct---gtttacgcacttcatactctttatattatgcaa |
1550681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University