View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_high_7 (Length: 427)
Name: NF1541_high_7
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 397; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Complemental strand, 43009118 - 43008702
Alignment:
| Q |
1 |
ttgaggttgttggtccctttgcttggtccagatgaaggaactttccccttaggaagcatgttcaggatcaatggcccatatgattttgcaccgcctcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009118 |
ttgaggttgttggtccctttgcttggtccagatgaaggaactttccccttagggagcatgttcaggatcaatggcccatatgattttgcaccgcctcttt |
43009019 |
T |
 |
| Q |
101 |
cccgtactactgatatgtgtccttccttctcctccggcattgccctctcacttggaagtgcgatgtttgaggtttctgcaagctggctgaaatcattcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009018 |
cccgtactactgatatgtgtccttccttctcctccggcattgccctctcacttggaagtgcgatgtttgaggtttctgcaagctggctgaaatcattcaa |
43008919 |
T |
 |
| Q |
201 |
gggcctagcagatgatgaagatgatattaatgataatagaatcagcagagctactgctaggtggaggttctgctttttctgtggcatttccattactcta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008918 |
gggcctagcagatgatgaagatgatattaatgataatagaatgagcagagctactgctagttggaggttctgctttttctgtggcatttccattactcta |
43008819 |
T |
 |
| Q |
301 |
ctgcctaaggaagttataaaggtttgagagaggaggatattgagaattaattgagatggcgtttgcagctgggattaggaagaaagagaagttagattta |
400 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008818 |
ctgcctgaggaagttataaaggtttgagagaggaggatattgagaattaattgagatggggtttgcagctgggattaggaagaaagagaagttagattta |
43008719 |
T |
 |
| Q |
401 |
gtttttaaggatctgtg |
417 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43008718 |
gtttttaaggatctgtg |
43008702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 43015375 - 43015289
Alignment:
| Q |
1 |
ttgaggttgttggtccctttgcttggtccagatgaaggaactttccccttaggaagcatgttcaggatcaatggcccatatgatttt |
87 |
Q |
| |
|
||||| |||||| ||| ||| ||||||| |||| ||||||| |||||||||||||||||| | |||||||| |||||| |||||| |
|
|
| T |
43015375 |
ttgagattgttgatccttttagttggtcctgatggaggaactccccccttaggaagcatgttgaagatcaatgtcccatacgatttt |
43015289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University