View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_low_22 (Length: 275)
Name: NF1541_low_22
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 260
Target Start/End: Original strand, 48027385 - 48027635
Alignment:
| Q |
10 |
caatgagttactacaaccaacaacaaccgcccgtcggcgttccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacacttcaat |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48027385 |
caatgagttactacaaccaacagcaaccgcccgtcggcgttccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacactttaat |
48027484 |
T |
|
| Q |
110 |
tcaactcttgcatgttaatttatcatcttgattcttgatctttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48027485 |
tcaactcttgcatgttaatttatcatcttgattcttgatctttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccgg |
48027584 |
T |
|
| Q |
210 |
agacttatggaaaagatgcttaccctccaccgggatatcctccacaaggtt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48027585 |
agacttatggaaaagatgcttaccctccaccgggatatcctccacaaggtt |
48027635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University