View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1541_low_28 (Length: 219)
Name: NF1541_low_28
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1541_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 40666382 - 40666575
Alignment:
| Q |
16 |
agggaccgcaatgagcacgatattaagctcgtcatcgatcatgttcatgccaagggtatcattctctcttccggtgacaggttgcttgtgctatgcatct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40666382 |
agggaccgcaatgagcacgatattaagctcgtcatcgatcatgttcatgccaaggatatcattctctcttccggtgacaggttgcttgtgctatgcatct |
40666481 |
T |
 |
| Q |
116 |
tgcataaggtgtcccaccctagtaagtgttatatcatattatcccgtctcttattactcgctttgttcatttttagctgttgttttagaattat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
40666482 |
tgcataaggtgtcccaccctagtaagtgttatatcatattatcccgtctcttattactcgctctgttcatttttagctgttgttttaaaattat |
40666575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University