View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15420_high_14 (Length: 236)
Name: NF15420_high_14
Description: NF15420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15420_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 103
Target Start/End: Original strand, 2448553 - 2448641
Alignment:
| Q |
15 |
aatattatccaaaaccatcttgtggatgaagaacaaaagaggttagggagaaactgaagtttctctcactgacttatagtaaacattta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
2448553 |
aatattatccaaaaccatcttgtggatgaagaacaaaagaggttagagagaaattgaagtttctctcactaacatatagtaaacattta |
2448641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 2448646 - 2448702
Alignment:
| Q |
165 |
ttgacataatcgcactcacaattaaaattaatgcacttcgctcttaaaggatatata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2448646 |
ttgacataatcgcactcacaattaaaattaatgcacttcgctcttagaggatatata |
2448702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University