View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15420_high_16 (Length: 219)
Name: NF15420_high_16
Description: NF15420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15420_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 56316015 - 56315831
Alignment:
| Q |
21 |
gtcgatttagaggaaggcgtcacaaatgcagggttctacctacaccaccgctatatcaagcctccaaaacctttttctattggaaatcaacatgcgtcac |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56316015 |
gtcgttttagaggaaggcgtcacaaatgcagggttctacctacaccaccgctatatcaagcctccaaaacctttttctattggaaatcaacatgcgtcac |
56315916 |
T |
 |
| Q |
121 |
taaccgccaccaccatttagctaagagggatttattaaattaaagagatttaaatccttaacccctgaaccgccacaatcctttg |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
56315915 |
taaccaccaccaccatttagctaagagggatttattaaattaaagagatttaaatccttaacccctaaactgccacaatcctttg |
56315831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University