View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15420_low_12 (Length: 380)
Name: NF15420_low_12
Description: NF15420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15420_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 209 - 367
Target Start/End: Original strand, 44515685 - 44515846
Alignment:
| Q |
209 |
ggaagacaaggtaaacc-ttaaatataacttttaatttatgtctttaattggtgtctgaattcgagggctgtctaggcgatatgaa--cttgaattttca |
305 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
44515685 |
ggaagacaaggtaaaccattaaatataacttttaatttatgtctttaattggtgtctgaatccgagggttgtctaggtgatatgaagacttgaattttca |
44515784 |
T |
|
| Q |
306 |
gtgatgttgtcttggtgattctgatctgtttctgtttgagcagaattataggtgtccgtctc |
367 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
44515785 |
gtgatgttgtcttagtgattctgatccgtttctgtttgagcagaattataggcgtctgtctc |
44515846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 44515625 - 44515692
Alignment:
| Q |
1 |
ttccgactgaaaaggccttcaaatatactggactacctgtggtttcttatgcaaatgagtggaagaca |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515625 |
ttccgactgaaaaggccttcaaatatactggactacctgtggtttcttatgcaaatgagtggaagaca |
44515692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 257 - 362
Target Start/End: Complemental strand, 29121146 - 29121038
Alignment:
| Q |
257 |
tggtgtctgaattcgagggc-tgtctaggcgatatgaa--cttgaattttcagtgatgttgtcttggtgattctgatctgtttctgtttgagcagaatta |
353 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||||| ||||||||||||| ||||||||||||| |||||||| | ||||||||||||||| || |
|
|
| T |
29121146 |
tggtgtttgaatccgagggcgtgtctaggcgatatgaagacttgaattttcagcattgttgtcttggtgtttctgatccttgtctgtttgagcagaagta |
29121047 |
T |
|
| Q |
354 |
taggtgtcc |
362 |
Q |
| |
|
|||||||| |
|
|
| T |
29121046 |
caggtgtcc |
29121038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 255 - 367
Target Start/End: Original strand, 1917411 - 1917526
Alignment:
| Q |
255 |
attggtgtctgaattcgagggc-tgtctaggcgatatgaa--cttgaattttcagtgatgttgtcttggtgattctgatctgtttctgtttgagcagaat |
351 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |||||| |||||| ||||||||||||| |||||||| | ||||| |||| |||| |
|
|
| T |
1917411 |
attggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgtcttggtgtttctgatccttgtctgtatgagtagaag |
1917510 |
T |
|
| Q |
352 |
tataggtgtccgtctc |
367 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
1917511 |
tacaggtgtccgtctc |
1917526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University