View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15421_high_3 (Length: 268)
Name: NF15421_high_3
Description: NF15421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15421_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 120 - 247
Target Start/End: Original strand, 31139017 - 31139144
Alignment:
| Q |
120 |
ctctacacgggtgtttgtttatacctaatgcttgtaggtttgaatattgaagaagggatgtccaactctcttgtgtatttacttttttggccaatatgat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31139017 |
ctctacacgggtgtttgtttatacctaatgcttgtaggtttgaatattgaagaagggatgtccaactctcttgtgtatttacttttttggccaatatgat |
31139116 |
T |
|
| Q |
220 |
gatccatgatccccctcaaaaccctaga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31139117 |
gatccatgatccccctcaaaaccctaga |
31139144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 31138898 - 31138952
Alignment:
| Q |
1 |
gtgagcttaacgtagttgtgtgtcaagtgtgggtaatgcaaaagtctcaccttat |
55 |
Q |
| |
|
||||||||||| || ||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
31138898 |
gtgagcttaacttaattgtgtgtcaaatgtggataatgcaaaagtctcaccttat |
31138952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University