View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15422_high_9 (Length: 352)
Name: NF15422_high_9
Description: NF15422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15422_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 18 - 345
Target Start/End: Complemental strand, 41024313 - 41023986
Alignment:
| Q |
18 |
aaaaatagcgcattggagttgttagtagatttcgtctttctgttaataaatatctagaaaggggaaagactttgaaggaaattgtatttatttgcctttc |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024313 |
aaaaatagtgcattggagttgttagtagatttcgtctttctgttaataaatatctagaaaggggaaagactttgaaggaaattgtatttatttgcctttc |
41024214 |
T |
|
| Q |
118 |
taagttactgaagtagtattacaaatatgaacactaagtaagccattaaccataatacaatagtattgccttgttttgaggatctagtgatcaaggtctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024213 |
taagttactgaagtagtattacaaatatgaacactaagtaagccattaaccataatacaatagtattgccttgttttgaggatctagtgatcaaggtctg |
41024114 |
T |
|
| Q |
218 |
cgaccacagtttggtccacgtcatgtcgagttttatgttgtcataaccgcaacgcgaccacgattgaggccgcaccaggcacatttgaccacaacagtta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024113 |
cgaccacagtttggtccacgtcatgtcgagttttatgttgtcataaccacaacgcgaccatgattgaggccgcaccaggcacatttgaccacaacagtta |
41024014 |
T |
|
| Q |
318 |
ctatgactgatattttaaacctttgcta |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41024013 |
ctatgactgatattttaaacctttgcta |
41023986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University