View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15422_low_14 (Length: 228)
Name: NF15422_low_14
Description: NF15422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15422_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 24697970 - 24697785
Alignment:
| Q |
13 |
gagatgaagatgtcttgtctgatctcaccttgttggagaaccagataccgattcggatcatctacttgctgcttagaacactttttcctgagttgactgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24697970 |
gagatgaagatgtcttgtctgatctcaccttgttggagaaccagataccgattcggatcatctacttgctgcttagaacactttttcctgagttgactgg |
24697871 |
T |
|
| Q |
113 |
atattctacttcggagggtgagaccaatattaataatcttatcctgtttattttaggctatcgtcaagatcggattctggacattc |
198 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24697870 |
atattctacttccgagggtgagaccaaaattaataatcttatcctgtttgttttaggctatcgtcaaggtcggattctggacattc |
24697785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 24536882 - 24536930
Alignment:
| Q |
13 |
gagatgaagatgtcttgtctgatctcaccttgttggagaaccagatacc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24536882 |
gagatgaagatgtcttgtctgatctcaccttgttggagaatcagatacc |
24536930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 24897293 - 24897248
Alignment:
| Q |
13 |
gagatgaagatgtcttgtctgatctcaccttgttggagaaccagat |
58 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |||||||| |
|
|
| T |
24897293 |
gagatgaagatgtcttgtctgatctcgctttgttggaaaaccagat |
24897248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 24856013 - 24855968
Alignment:
| Q |
13 |
gagatgaagatgtcttgtctgatctcaccttgttggagaaccagat |
58 |
Q |
| |
|
|||| |||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
24856013 |
gagacgaagatttcttgtctgatctcactttgttggaaaaccagat |
24855968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University