View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15423_high_41 (Length: 335)
Name: NF15423_high_41
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15423_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 324
Target Start/End: Original strand, 23918510 - 23918816
Alignment:
| Q |
21 |
actctcagctccccggtggctatccatggagagggatcaattcttcatttacnnnnnnnctttccattttctcttatccattatgaccttctttttattc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918510 |
actctcagctccccggtggctatccatggagagggatcagttcttcatttactttttttctttccattttctcttatccattatgaccttctttttattc |
23918609 |
T |
|
| Q |
121 |
ttgaagggtggtgtcagctaggaaggattagttccgtatctcctctttatcaaatcaactccttcgattccgcaaag---gtggtgttgacagggagtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
23918610 |
ttgaagggtggtgtcagctaggaagggctagttccttatctcctctttatctaatcaactccttcgattccacaaagaaggtggtgttgacagggagtct |
23918709 |
T |
|
| Q |
218 |
ttgacttctccatgttcgcttgagtacatagtgttggctaggagtcttagactgcttcacgttcactcgagcacaaagtttctgctaggattctctgact |
317 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
23918710 |
ttgacttctccatgttcgcttgagcacatagtgttggctaggagtcttagactgcttcacgttcactcgagcacaaggtttctgctaggaggctttgact |
23918809 |
T |
|
| Q |
318 |
tcttcat |
324 |
Q |
| |
|
||||||| |
|
|
| T |
23918810 |
tcttcat |
23918816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University