View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15423_high_48 (Length: 291)
Name: NF15423_high_48
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15423_high_48 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 274
Target Start/End: Original strand, 34672537 - 34672797
Alignment:
| Q |
14 |
aggtgaaggacaaacaatggaggttattcagcaagccaagcttgattctcttataaatccttatacaaggagctggaattataatgctattaattattat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672537 |
aggtgaaggacaaacaatggaggttattcagcaagccaagcttgattctcttataaatccttatacaaggagctggaattataatgctattaattattat |
34672636 |
T |
|
| Q |
114 |
tttgatcatggtattgtacaacgtattcttaggacacctctatttaatcaggtagaggaggaccaattaatatggaaggctgagaggaacgggcactact |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| | |
|
|
| T |
34672637 |
tttgatcatggtactgtacaacgtattcttaggacacctctatttaatcaggtagaggaggaccaattaatatggaaggccgagaggaacgagcactatt |
34672736 |
T |
|
| Q |
214 |
ctgtcagaagcatgtatcgtttgtgtatggaagaaataggggatatttcatatttacacag |
274 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672737 |
ctgtcagaagcacgtatcgtttgtgtatggaagaaataggggatatttcatatttacacag |
34672797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 15332429 - 15332481
Alignment:
| Q |
227 |
gtatcgtttgtgtatggaagaaataggggatatttcatatttacacagactgg |
279 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| ||||||||| ||||| |||| |
|
|
| T |
15332429 |
gtatcatttgtgtatggaagaaatagaggataattcatatttgcacaggctgg |
15332481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 291
Target Start/End: Original strand, 7175127 - 7175250
Alignment:
| Q |
168 |
gaggaggaccaattaatatggaaggctgagaggaacgggcactactctgtcagaagcatgtatcgtttgtgtatggaagaaataggggatatttcatatt |
267 |
Q |
| |
|
||||||||||||||||| ||||| || |||| || || || || || || |||||| ||| || | |||||||||||||| || |||| ||| ||| |
|
|
| T |
7175127 |
gaggaggaccaattaatttggaaagccgagaaaaatggacattattccgttagaagcgcgtaccggatttgtatggaagaaattggtgataattcgtatc |
7175226 |
T |
|
| Q |
268 |
tacacagactgggtttttggaatg |
291 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
7175227 |
tacacagaccgggtttttggaatg |
7175250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University