View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15423_high_51 (Length: 275)
Name: NF15423_high_51
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15423_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 46093597 - 46093361
Alignment:
| Q |
14 |
attctaaattccccaaccg-tccacatacatgttattcagaaattgggacctcttggtaactcaaattggaaagttacatgtttgaggtaaaacggcata |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46093597 |
attctaaattccccaaccggtccacatacatgttattcagaaattgggacctcttggtaactcaaattggaaagttacatgtttgaggtaaat-ggcata |
46093499 |
T |
 |
| Q |
113 |
ttatgaacnnnnnnngctacagctttcagaactggcccctatgaattattatgtgttttatatggttaccaaattggccactttcactacatgattattt |
212 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46093498 |
ttatgaacaaaaaaagctacagcttttagaactggcccctatgaattattatgtgttttatatggttaccaaattggccactttcactacatga------ |
46093405 |
T |
 |
| Q |
213 |
attatacccgtatcagcatcaaatgcgataactcgacgatgatgg |
257 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46093404 |
-ttatacccgtaccagcatcaaatgcgataactcgacgatgatgg |
46093361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University