View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15423_high_55 (Length: 260)
Name: NF15423_high_55
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15423_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 51687096 - 51686857
Alignment:
| Q |
1 |
tgctataccaactcaaacactcacatgaaaacaaaatacttggaaggaaagggttgcagttatggatgaaaaaaccctatgaattgatgggtgatgcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51687096 |
tgctataccaactcaaacactcacatgaaaacaaaatacttggaaggaaagggttgcagttatggatgaaaaaaccctacgaattgatgggtgatgcaaa |
51686997 |
T |
 |
| Q |
101 |
agagagaaaaactgaaattgtcatgaaagaaaataaggtggaagaggaagaaccggaggatgtagaggacatgattgatgaagaagacaaggaagaagag |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51686996 |
agagagaaaaactgaaattttcatgaaagaaaatacggtggaagaggaagaaccggaggatgtagaggacatgattgatgaagaagacaagg---aagag |
51686900 |
T |
 |
| Q |
201 |
gaggaagaaaacgaagcagtagatgcagatatgagcttattcg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51686899 |
gaggaagaaaacgaagcagtagatgcagatatgagcttattcg |
51686857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University