View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15423_high_57 (Length: 256)
Name: NF15423_high_57
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15423_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 79 - 246
Target Start/End: Original strand, 36689166 - 36689333
Alignment:
| Q |
79 |
aacaaaaggaagttttggcattgatgtacgctttcgttataattttggccaatttgttcatgcttactcatgatgatttcaatttgaggcttcagcggct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36689166 |
aacaaaaggaagttttggcattgatgtacgctttcgtgataattttggccaatttgttcatgcttactcatgatgatttcaatttgaggcttcaacggct |
36689265 |
T |
 |
| Q |
179 |
gaaagcgaagctaccacccttcatgttgcaatgcgcaaattacgattgatagtgaatgtcagcctttg |
246 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36689266 |
gaaaccgaagctaccacccttcatgttgcaatgcgcaaactacgattgatagtgaatgtcagcctttg |
36689333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 36689109 - 36689142
Alignment:
| Q |
20 |
ttatgaatttgaggaagaagatgacattgaagat |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36689109 |
ttatgaatttgaggaagaagatgacattgaagat |
36689142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University