View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15423_high_60 (Length: 248)
Name: NF15423_high_60
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15423_high_60 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 42 - 248
Target Start/End: Complemental strand, 7804839 - 7804633
Alignment:
| Q |
42 |
tacttttctcaagataaatagatagatagactagtttttaggactcaataggtcattgtgnnnnnnnataagaaaattaaactaaaatgggtgcaattag |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7804839 |
tacttttctcaagataaatagatagatagactagtttttaggactcaataggtcattgtgtttttttataagaaaattaaactaaaatgggtgcaattag |
7804740 |
T |
 |
| Q |
142 |
gggtttacagtgaaagggttatttgatccatatccgaccgtgtcaatttttagatccgaacccgatcaaaaatttaatcaaattcggtgaagtacaagtt |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7804739 |
gggtgtacagtgaaagggttatttgatccatatccgaccgtgtcaatttttagatccgaacccgatcaaaaatttaatcaaattcggtgaagtacaagtt |
7804640 |
T |
 |
| Q |
242 |
caataaa |
248 |
Q |
| |
|
||||||| |
|
|
| T |
7804639 |
caataaa |
7804633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University