View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_high_10 (Length: 428)
Name: NF15424_high_10
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 7e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 161 - 408
Target Start/End: Original strand, 38544410 - 38544649
Alignment:
| Q |
161 |
atcataaaaatcataacctacatactcatcatcacacaatggatatgatggcttcttctcatgaatttgtaaaattgtaaaagatcattttaattgtgcg |
260 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38544410 |
atcataaccatcataacctacagactcatcatcacacaatggatatgatggcttcttctgatgaatttgt--------aaaagatcattttaattgtgcg |
38544501 |
T |
 |
| Q |
261 |
aatcgatcattgtttataattgacaatgatcttattctttagccacctctcacactattctagaagacttcttcaatgccctagacgttttcaacgtttt |
360 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38544502 |
aatcgatcattgtctataatagacaatgatcttattctttagccacctctcacactattctagaagacttcttcaatgccctagacattttcaacgtttc |
38544601 |
T |
 |
| Q |
361 |
ctattcaaatttcaaaggctgtgtttgaaaaagtttactactgaacac |
408 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38544602 |
ctattcaaatttcaaaggttgtgtttgaaaaagtttactactgaacac |
38544649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University