View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15424_high_21 (Length: 299)

Name: NF15424_high_21
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15424_high_21
NF15424_high_21
[»] chr7 (2 HSPs)
chr7 (1-187)||(48963713-48963901)
chr7 (187-284)||(48963563-48963660)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 48963901 - 48963713
Alignment:
1 attgttaaaattccaactccaatacgtatgtcttgctggttgaattagagagtgaatatgatccgcaaaattgttttggatctgatctttaaagaatgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||    
48963901 attgttaaaattccaactccaatacgtatgtcttgctggttgaattagagagtgaatatgatccgcaaaattgttttggatc---tctttaaagaatgaa 48963805  T
101 taaaatgaatttcaacactactttgacaaactat-----atctgatgtgctacaaatttacaatgatgcaacaagtctcacacatattcatt 187  Q
    ||||||||||||||||||||||||||||||||||     ||   ||| | ||||||||||||||||||||||||||||||||||||||||||    
48963804 taaaatgaatttcaacactactttgacaaactataatgaataaaatgcgttacaaatttacaatgatgcaacaagtctcacacatattcatt 48963713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 187 - 284
Target Start/End: Complemental strand, 48963660 - 48963563
Alignment:
187 tttcaataaatctgttagcaacaagtgattcaatgtcaattattattatgtctaaatttcaatatcataaaaacgtagacatgcaattgaaaaaacat 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
48963660 tttcaataaatctgttagcaacaagtgattcaatgtcaattattattatgtctaaatttcaatatcataaaaatgtagacatgcaattgaaaaaacat 48963563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University